baptipriQu7e6 baptipriQu7e6

20-11-2015
Biology

contestada

Chemical bonds that involve the total transfer of electrons from one atom or group of atoms to another are called

Respuesta :

keikeikei keikeikei

20-11-2015

these are called ionic bonds

Answer Link

Otras preguntas

Read the information in the brainstorming table. Beginning: First, I signed up to audition for a part in the school play. Middle: Then I recited my lines and sa

what is the answer to the question?

A store starts the day with 36 packages of juice boxes.Each package contains the same number of juice boxes.By the end of the day,ther are only 8packages of jui

Which one has more Thermal Energy? A cup of boiling water or a bathtub of warm water? Explain! Please answer if you can, thank you!! P.S this is science but i j

Use the following image to answer the question. alt= Which of the following labels completes the chart? (3 points) Question 9 options: 1) County court 2) U.S

how many moles of CO2 are produced from the combustion of 5.25 moles of CH3OH?

True or False Rivers in Africa flow from the top of the African Plateau down to the Oceans

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

HELPPP !!! Lennon is depositing $1,250 in a bank account that earns 4% compounded annually. After 2 years , how much will Lennon have in his account ? A 1350B 1

Study this map, and then answer the question. How far away is the city of Damascus from the city of Jericho? 1 mile 5 miles 40 miles 100 miles