figueroamelany316 figueroamelany316

19-12-2020
Biology

contestada

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Respuesta :

raduoprea160 raduoprea160

19-12-2020

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

Otras preguntas

What eats only producers? (plants & plant like organisms)

A geologist is looking at deposits along a river below a large volcano. she finds large boulders mixed with sand and mud, and all of the material is comprised o

The steps below show the incomplete solution to find the value of y for the equation 6y − 3y − 5 = −3 + 23: Step 1: 6y − 3y − 5 = −3 + 23 Step 2: 6y − 3y − 5

Find the reference angle for the given angle. Show your work. -404°

Classify each solid as a covalent, ionic, metallic, or molecular solid. Drag the appropriate items to their respective bins. HelpReset frozen ethanol calcium fl

How much should i weigh at 5'4 and 13 years old?

(9x4 + 3x3y - 5x2y2 + xy3) ÷ (3x3 + 2x2y - xy2)

A 4,000 ml solution of agno3 contains 17.00 g of solute in water. calculate the molar concentration of the solution. 0.03 m 0.4 m 908 m 700 m

Calculate the maximum mass in grams of h2s that can form when 165 g aluminum sulfide reacts with 125 g water according to:

What eats only producers? (plants & plant like organisms)