Seudónimo Seudónimo
  • 20-09-2017
  • Mathematics
contestada

The number 0 belongs to which classification?

A. irrational numbers

B. natural numbers

C. integers

D. all of the above

Respuesta :

jailynnmonroe39 jailynnmonroe39
  • 20-09-2017
Your answer will be C. Integers
Answer Link
dancinginthedar
dancinginthedar dancinginthedar
  • 21-09-2017
The answer is C. Integers
Answer Link

Otras preguntas

¿Qué prefieren ustedes el almuerzo o el desayuno? Nosotros ___________ el almuerzo. Group of answer choices prefieren prefiere prefiero preferimos can anyone f
what are the nfl players wearing around their neck?
Evaluate the expression shown below and write your answer as a fraction in simplest form. 7/10 + 1/6
Problem 1: Describe and Correct the error in finding the sum of interior angles for an 18-gon. X n. 180° = 18. 180° = 3240°
Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
komics grade-7 konsensya
I served as both Vice President and President. During my presidency, I tried to maintain peace and I did not go to war with France. Who am I? A. George Washingt
Which of the following equations is equivalent to -5(x-1)=2x+15 Select one: -7x =14 -7x =20 -7x =10 -7x =16
pros and cons of unitary government
-4(a+2)-1 = -5a PLEASE SHOW STEPS