marandajane marandajane

19-01-2023
Biology

contestada

Transribe and translate the following dna strand
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Respuesta :

Otras preguntas

What role does DNA play in the expression of traits

A broken clock is set correctly at 12:00 noon. However, it registers only 20 minutes for each hour. In how many hours will it again register the correct time?

who said "The advance of the frontier has meant... a steady growth of independence on American lives"?

The sales tax in Alex's city is 7.33%. He bought a video game system for $299, and 2 games each at $49 each. What was the TOTAL bill, to the nearest tenth?

14 boys and 11 girls. What is percent of girls

The Red Scare began after _________

In 'Flowers for Algernon' what is Charlie Gordon's birthday and hometown?

What is it called when you take over a country? It cant be imperilizm or conquer

What is an enzyme that changes peptides to amino acids?

I cannot answer this question 20.4= ? tenths