lanierwilliam1423 lanierwilliam1423

16-03-2021
Mathematics

contestada

You just looked at the graph of this system of equations. Why will the lines never intercept?
y=-x+5
y=-x-3

Respuesta :

16-03-2021

Answer:

Step-by-step explanation:

The have the same slope, -1, but different y-intercepts. The lines are parallel.

Answer Link

fhdjnbfdhsj fhdjnbfdhsj

20-03-2021

Answer:

The linear equations have the same slope, so the rate of change for each is the same. As long as the rate of change is the same, the lines will stay the same distance apart and not intersect.

Answer Link

Otras preguntas

Now moles: moles of H2+ A moles of O2 moles of H20

help!! it's algebra 2!

Solute x/3=5 do this question step vise

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Solve for x. (Simplify)

send help ive got a ton of questions in history!

The production of which substance by using cell technology allows scientists to make treatments that can target specific types of cancer cells? O steroid hormon

In 1800, took over ownership of the Louisiana colony. Due to concerns about rebellions by enslaved people, the Code Noir was . Also at this time, the enslave

Sandra's Bike Club had 360 members last month. Each member pays a $12 membership fee per month. This month, 27 new members joined and 34 members left the club.

Find the domain and the range of the following: x y 3 2 5 7 1 4 9 2 3 7