deebee06 deebee06
  • 21-01-2021
  • Mathematics
contestada

Work out the area of the trapezium ABDE.

Work out the area of the trapezium ABDE class=

Respuesta :

ahmedtitoo16
ahmedtitoo16 ahmedtitoo16
  • 21-01-2021

Answer:

(half * base 1 * base 2)/height

base 1 is 6 and base 2 is 9

get the height from similarity

6/9 = 8/CE

therefore CE = 72/6

Answer Link
Charmber06
Charmber06 Charmber06
  • 07-10-2021

Answer:

30cm²

Step-by-step explanation:

AE/BD = CE/CD

9/6 = CE/8

CE = 9/6 x 8

CE = 12cm

DE = CE - CD

DE = 12 - 8 = 4 cm

½(6 + 9)4 = 30cm²

Answer Link

Otras preguntas

Estimate the product of 71.92 and 2.01
I need help is it A B C or D
What president was not granted executive, legislative and judicial power?
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
The prefix which means into is _____. un ir in
Beatriz is reading a book tgat has 530 pages. If she reads 10 pages a day, how many days will it take her to finish the book?
You’re boss has asked you to review various processes for problem solving to help you with your job. The IDEAS process is a process used often at the office. Qu
What was discovered in 1848 that caused settlers to rush to california? a. oil b. silver c. gold d. diamonds
How do Telemachus's actions in battle compare to his father's?
A positively charged object will attract an object that has