18-11-2016
Biology

contestada

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT
TACGCGACGTGCACGTGCAA MRNA-----

Respuesta :

18-11-2016

I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.

ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA

mRNA

UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU

Answer Link

Otras preguntas

find rodrigos percent increase or decrease in sales each week. week 1, is 17 wwek 2, is 25 week 3, is 18 and week 4, is 27. his boss said that he wants the incr

Which is the best term to use when describing the energy of position? chemical kinetic potential electromagnetic

2x + 3y = 82x-2y=-12

Acceleration causes a shift of weight to the ______.

Who takes over if the Arizona governor resigns in the middle of a term?

PLEASE HELP PLEASE!!!!! Which of the following was an after-effect of the tornado outbreak on May 3, 1999?A.the complete destruction of 3,000 buildingsB.the dea

I need help with number 5

Body Types. there are three basic body types called somatotypes: A.Large bones B.Short Neck C.Young Appearance D.Rectangular shaped

Write the product in its simplest form: 6b^2• (-b^7)

In a famous speech at the beginning of World War I, President Wilson declared that the United States would