AngelicaRaeR987765 AngelicaRaeR987765
  • 19-10-2016
  • English
contestada

Every culture has a word for democracy. True False

Respuesta :

MatthewT123
MatthewT123 MatthewT123
  • 19-10-2016
the correct answer is true
Answer Link
Minister
Minister Minister
  • 19-10-2016
i think its false but i could be wrong

Answer Link

Otras preguntas

What is 7√27 + 5√48 in simplified form?
how do babys grow in the womb?
The seven members of the stabler family like to eat oatmeal for breakfeast .Mr.Stabler can make 16 individual servings from one box of oatmeal.If each family me
Which calculation will ALWAYS give a result greater than 11?
A war in Mexico would he under _______ command.A.) PacificB.) SouthernC.) NorthernD.) Central
How did the New Madrid earthquakes affect the state of Tennessee? * A.It gave Tennessee its first real lake. B.It destroyed all towns in Middle Tennessee. C
To make a batch of fruit punch, Steve needs 2  2/3 cups blackberry juice.  If he wants to make 2  ¾ batches of punch, how many cups of blackberry juice will he
Harry rides his bike 25 3 over 8 karen rides her bike 25 3 over 8 Who rode further
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
In what ways can music be used in theatre