albaiannnnnn albaiannnnnn

16-11-2020
Mathematics

contestada

Your wrong but i can help you :) luck next time man

Respuesta :

NonyaBuisness2 NonyaBuisness2

16-11-2020

Answer:

?

Step-by-step explanation:

Answer Link

Otras preguntas

explain the quote in your own words. “When men are at war, there is no new business, no navigation, nor trade; no big buildings, no knowledge of the face of the

Which of the following is applied on thermoplastic polymers? Select one: a. Their shape is determined as part of the chemical process groups b. They can be melt

What type of painting was popular during the Renaissance because of the interest in people due to Humanism as seen in the Mona Lisa and Botticelli painting? A.p

The following is an example of what? The sun shines in the sky - A It shines so very high - A rhyme scheme meter iambic pentameter elegy

what is meaning of Wings made up of feather

What's the difference between Subcommittee Review and Committee Review?

If n is an integer and n×10 is a negative number, which of the following statements must be true? n < 0 n > 0 n = 0 None of the above.

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

In what ways has Lincoln's political goals shifted during the Civil War?

In a sample of 1000 U.S. adults, 198 think that most celebrities are good role models. Two U.S. adults are selected from this sample without replacement. Comple