nayfresh123 nayfresh123

19-05-2020
Mathematics

contestada

What is the cost of 1 Apple and of 3 apples?

Respuesta :

WildAces WildAces

19-05-2020

Answer:

The cost of 1 apple is a third of the price of 3 apples

Step-by-step explanation:

google says that apples are $1.49 a pound

1=$1.49

3=$4.47

Answer Link

Otras preguntas

What type of reaction does each of the following equations represent? NH4OH>NH3+H20 A. Single replacement B. Decomposition C. Double replacement

What is the equation of the line that passes through the point (-6, -7) and has a slope of o?

If something looks larger, smaller, or a different shape on a map than in reality, or appears to be out of place, it is probably a result of _____. 1,outdated r

Maria walked 3 km west and 4 km south. Calculate how far she is from her starting point.

The next step includes more people

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Olve for x. Check each step or answer that is correct. 34(x + 4) = 14(x + 8) (A) Distribute 34 on the left side of the equation. (B) Distribute 14 on the right

help me please on letter b

can you answer my screenshot

Dibuja un segmento de 6cm y su mediatriz construye un triángulo con dos de sus vértices en los extremos del segmento y el tercer vértice sobre la mediatriz ¿qué