coats264 coats264

18-05-2020
English

contestada

How does Harrison bergerons physical description help create satire

Respuesta :

Аноним Аноним

18-05-2020

Answer:

The absurdity of Harrison's exaggerated handicaps ridicules society's obsession with equality.

Explanation:

hope this helps

Answer Link

Otras preguntas

What visual element is commonly added to a text trailer to make it more engaging for potential readers? background music decorative borders characters' names ta

Which statement about the differences between colonies and spheres of influence is false? In a sphere of influence, the country's government and other national

Angle B measures 60. What is the measure of the angle that is complementary to angle B ?

Analyze the image below and answer the question that follows. A painting of Americans in covered wagons migrating out West in the winter. Painting by C.C.A. Chr

Prompt: In the poem "Mother to Son" by Langston Hughes, the speaker talks about a difficult time and how she kept going despite hardships. Think of a time when

Haze has become an inevitable phenomenon in big cities. What are the major emission sources have been discussed very much. Now you obtained the inhalable partic

is braily good for u or are u just cheating

what is x ÷ t/4 = -6/13

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

helpp me pleasee ╹◡╹