yvonnermccoy yvonnermccoy

19-11-2018
Mathematics

contestada

what value is missing in the third position of the geometric sequence below? 5 ,-15,___ -135 , 405

Respuesta :

angel0411913 angel0411913

19-11-2018

the missing answer is -45

Answer Link

Otras preguntas

Laura is working on an art project she needs a rusty iron nail for her art work so she places a shiny new nail outside in it wet locations how will the air and

What is the definition of the German word Volksblatt?

EXPLAIN: How does the amount of a substance affect the rate at which temperature changes?

Should the sentence "The traffic accident will be investigated." Remain passive?

In which way do you like to work? Individually or in group? why??

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

What does bondpeople mean as a nineteenth century term

Continental plates pushing together cause mountains to form on our planet Earth. A. TRUE B. FALSE

Find the quotient. 48j 5 k 2 ÷ (-3j 3 k) a.) -16j2k b.) -16j3k2 c.) -16j3k

Here are dimension of the oven tray Jenny bakes the cakes each cake tins is 25cm in diameter how many cake tins can Jenny fit on the oven tray