sheenansprout17 sheenansprout17

16-03-2018
Advanced Placement (AP)

contestada

5. When driving in fog or snow, __________ A. use your high beams. B. use your low beams. C. drive at the posted speed limit.

Respuesta :

Ketaмinє Ketaмinє

16-03-2018

The answer is, "B", "Use your low beams".
Low-beams are the lights that are under your regular headlights, and assist you in the seeing the ground, rather than in front of you, perfect for fog and snow storms.

Answer Link

linds3401 linds3401

16-03-2018

The answer is B. Use your low beams.

Hope this helps!! ;))
Have a grat day!! <3

Answer Link

Otras preguntas

Please order the following choices to reflect the appropriate sequence of materials used in the Gram staining procedure. Rank the options below. safranin safran

A recent study Indicated that 27% of the 142 women over age 55 in the study were widows

Visions of which food danced in children’s heads as they slept in the poem ""‘twas the night before christmas?""

max is thinking of a number he calls n he adds 8 and then doubles the sum

press: 40/50 Which Supreme Court case requires the police to inform a suspect in custody of their Fifth Amendment rights prior to questioning?

Pls helppppppppppppppp

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

What is the elevation change between Position A and B?

Which type of function describes f(x)?

A company considering outsourcing must realize that the solution can be only as good as the outsourcing firm that provides the service. a. True b. False