Mady93002
Mady93002
17-10-2015
Mathematics
contestada
In the equation -2(2-r)=4(5-r) what is r?
Respuesta :
konrad509
konrad509
17-10-2015
[tex]-2(2-r)=4(5-r)\\ -4+2r=20-4r\\ 6r=24\\ r=4[/tex]
Answer Link
VER TODAS LAS RESPUESTAS ( 28+ )
Otras preguntas
PLEEAAASSEEEE ANSWEERRRR I WILL MARK BRAINLIEST!!!!! Answer the following question in 3-4 complete sentences. Define a drawdown. Explain the specific effects of
what us the length of AC?
There is a 10% chance you will get in a serious car accident, incurring damage of $1,990. (There is a 90% chance that nothing will happen.) Your utility functio
Make v the subject of the relation KE = ½mv²
GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra
HELP!!! 2(4x+3)=x+1 It's geometry!
For which reason do humans drain wetlands? les A) to prevent loss of wildlife B) agricultural and commercial use the need for more drinking water D) to harvest
Read the excerpt from The Miracle Worker by William Gibson. KATE: [TOO QUICKLY] What did she spell? ANNIE: I spelled card. She spelled cake! (She takes in KATE’
Can someone plz help me, I’ve been stuck on this question for ever
Was Mexico wealthier after the revolution?