dhyatagandhi dhyatagandhi
  • 17-11-2022
  • Mathematics
contestada

Find the value of $x$ so that the ratios are equivalent.

$x:\frac{5}{2}$
and $8:10$

Respuesta :

Otras preguntas

Could someone help me with this?
Help quick simple works out
In one to two paragraphs identify your favorite part of the performance and explain what worked really well in the show. You should also include recommendations
Summarize the impact of the biblical narratives on art, music, literature, and culture of the Western world.
Why does the moon have such a great influence on the tides? A.The moon is larger than the sun. B.The sun has a greater influence on the tides than the moon. C.
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
A book sold 35400 copies in its first month of release. Suppose this represent 9.7 % of the number of copies sold to date. How many copies have been sold to dat
Where does the speaker find pleasure in​
If a person has a_rate of absorption, then their BAC is likely to reach a high level more quickly. Aslow B. fast C. altered
How can healthcare professionals prevent infections from spreading? A. by reusing disposable gloves after handling samples B. by laundering bedding after usin