YaBoiLorenzoT YaBoiLorenzoT

20-01-2022
Mathematics

contestada

Bertha adds 5 to a number, then multiplies the sum by negative 2. The result is 6. Write and solve an equation to find the number, x.

Respuesta :

jen4755 jen4755

20-01-2022

Answer:

-8

Step-by-step explanation:

Take the number, x and follow the steps

(x + 5) * -2 = 6

Then solve the equation

(x + 5) = -3 Divide each side by -2

x = -8 Subtract 5 from each side

Answer Link

hf0028321 hf0028321

20-01-2022

Answer:

[tex] - 2(x + 5) = 6 \\ - 2x - 10 = 6 \\ - 2x = 16 \\ x = - 8[/tex]

Answer Link

Otras preguntas

When studying history, asking questions and checking other sources will improve one's perspective.

To what body system does this structure belong?

Which of the following contradicts Tocqueville’s understanding of egalitarianism:

Madison has $1. She spent $0.90. What percent of a dollar did she spend?

Find the inverse of the function y = 7x - 4 by showing all steps.

a vehicle moving at a constant speed travels 45 miles in 3/4 hour. the driver thinks he will be late to a meeting that is still 65 miles away and starts in 1.25

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

Identify the following group of words as either a complete sentence or a fragment. Skated the program beautifully. complete sentence fragment

In Urdu is there an actual word for "please" ??

The term "popular music" has become synonymous both with the term "contemporary music" and the termclassical music.rock and roll.folk music.rhythm and blues.