sarahbruby
sarahbruby sarahbruby
  • 18-10-2021
  • Mathematics
contestada

Hello can someone help please :)

Hello can someone help please class=

Respuesta :

DᴀʀᴋPᴀʀᴀᴅᴏx
DᴀʀᴋPᴀʀᴀᴅᴏx DᴀʀᴋPᴀʀᴀᴅᴏx
  • 18-10-2021

[tex]▪▪▪▪▪▪▪▪▪▪▪▪▪  {\huge\mathfrak{Answer}}▪▪▪▪▪▪▪▪▪▪▪▪▪▪[/tex]

The values of x for which f(x) = 8 are :

  • x = 6

  • x = -6

Answer Link

Otras preguntas

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC
find HCF of 96 and 404 by prime factorization method and find their LCM ​
1. CIRCLE the correct verb form to complete the sentence. (5 points) .1 The presentation you (gave / were giving) in class was very interesting. .2 Everyone
fractional disstilation
Which expression represents the phrase "5 less than a number"? Question 3 options: n 5
______ occurs when people are hired or promoted, or denied hiring or promotion, for reasons not relevant to the job
i need help w this question
Using the fixed-order-quantity model, which of the following is the total ordering cost of inventory given an annual demand of 36,000 units, a cost per order of
The formula for the volume V of a rectangular prism is V = ℓwh, where ℓ represents the length, w represents the width, and h represents the height. Rearrange th
what is the difference between a repeating decimal and a terminating decimal​