tayrudgley tayrudgley

17-08-2021
English

contestada

The sensory neurons in your skin relay information to________on the to the brain?
A. The spinal cord
B. The brain
C. The foot
D. The head

Respuesta :

PossumTrash PossumTrash

17-08-2021

The answer is A. The spinal cord

Answer Link

Otras preguntas

Fungi, like bacteria, help to convert dead plants and animals and their wastes into ammonia (NH3) in the soil. Plants absorb nitrates from the soil to make prot

What makes a song an anthem?

number talk 4 fraction number line

Use the paragraph below to answer questions 1-12. fill in the blank using the correct vocabulary word from the word bank or correct *Preterit* form of the verb

What environmental factors do aquarium designers need to consider?

what does 4x+y=5 in finding x and y intercepts?

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d

Find m<1 Please please

What is the rate of change of the function described in thetable? 12/

Describe the cycle that Buck experienced from being a king, to being kidnapped, to returning to a king. Why was Buck able to rise to the challenge and master ea