mariferfigo1772 mariferfigo1772
  • 16-08-2021
  • Mathematics
contestada

solve for variable. 3p/5 + 8/5 =1

Respuesta :

Аноним Аноним
  • 16-08-2021

[tex]\\ \sf\longmapsto \dfrac{3p}{5}+\dfrac{8}{5}=1[/tex]

[tex]\\ \sf\longmapsto \dfrac{3p+8}{5}=1[/tex]

[tex]\\ \sf\longmapsto 3p+8=5[/tex]

[tex]\\ \sf\longmapsto 3p=5-8[/tex]

[tex]\\ \sf\longmapsto 3p=-3[/tex]

[tex]\\ \sf\longmapsto p=\dfrac{-3}{3}[/tex]

[tex]\\ \sf\longmapsto p=-1[/tex]

Answer Link

Otras preguntas

solve for the markup rate
If the flow rate in s pipe is 2L/s what does that tell you about how fast the water is moving?
HELP!!!!! component of U.S foreign policy​
Mary plants roses in 1/4 of her garden. She also plants some tulips in her garden. She has 1 1/2 of the garden left to plant more flowers. What fraction of Mary
Can someone solve -2x - 4 ≤ 11 ?
Read the passage from "The Most Dangerous Game.” "And if I win—" began Rainsford huskily. "I'll cheerfully acknowledge myself defeat if I do not find you by mid
Hamsa is hiking at a rate of 4 miles per hour. At this rate, how long will it take him to hike 18 miles?
Which of the following areas is MOST LIKELY to have retained its local indigenous culture? O city on a coastal plain O village on the trans-country railway O co
Hi can someone help me with this
Use the restriction enzyme EcoRi to cut DNA Victim DNA : GGAAG ATTCTACATTACTGACGGACGTGACGTGA CCTTCTTAA GATGTAATGACTGCCTGCACTGACT Number of restriction fragmen