4804378780 4804378780

18-02-2021
Biology

contestada

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Respuesta :

malakmohammed0101 malakmohammed0101

18-02-2021

CUGCUACAUCGUAGCUGGUAAC

Answer Link

Otras preguntas

Which method would be important to use while writing

the first Indianapolis 500 auto race took place in 1911. the winning car covered the 500 miles in 6.7 hours. what was the winning cars average rate of speed in

Which type of muscle is used primarily for voluntary actions?

a space shuttle can travel 18000 miles per hour in orbit. at this rate how far cam it travel in 24 hours

what is 10 months after July

What is the function of the relative pronoun in the adjective clause? The essay describes the mountain that I climbed. A. subject B. object of a preposi

Evolution _____. doesn't happen below the species level is always caused by mutation is a slow, gradual change over time happens very quickly

Which of the following progressive reforms mandated an 8 hour workday for railroad workers? A. the Hepburn Act B. the Mann Act C. the Adamson Act D. Federal Res

The _______ form of city government merges executive and legislative functions in a single group of officials. A. township B. mayor-council C. commission D. cit

What should you always avoid in formal writing? A. Slang or filler words B. Complete sentences C. Dates and signatures D. A personal voice