mermaidmadz
mermaidmadz mermaidmadz
  • 17-11-2020
  • Mathematics
contestada

I can't seem to figure it out lol.​

I cant seem to figure it out lol class=

Respuesta :

saraelkhelyfy saraelkhelyfy
  • 17-11-2020

4y+2x+y+79-x=180°

5y+x=101

X=101 -5y

-------

Answer Link

Otras preguntas

To cells that are defective in primer removal, you add fluorescent ribonucleotides when the cells are undergoing dna replication. in this case, you observe that
What contrasting imagery does Trumbull use to describe his vision for the future of the nation?
What is the PSAT Selection Index score used to determine?
4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid 5’ agcgggatgagcgcatgtggcgcataa
What is the product of 9.0581 × 3.7? 33.51497 335.1497 3351.497 33,514.97
(x^2-4x+5)+(7x^2+2x-3)(7x^2+4x-6)-(2x^2-3x+1)add or subtract
Find the measure of both arc AB and arc APB, where <APB = 108◦.  Please be sure to show your steps.Can someone please help me. I'm not asking for the answer,
For a standard deck of playing cards, find the probability that a queen randomly selected from the deck is a diamond.
(4x)^-2 (4x)^3(4x)^9= (4x)
In most spanish-speaking countries, married women legally ____. adopt their husbands' surnames retain their maiden surnames in the name maría antonia abad ferná