quirkybread
quirkybread quirkybread
  • 19-11-2019
  • Mathematics
contestada

what is the vertex form of the equation y=-x^2 + 12x-4

please show all steps!

Respuesta :

aliassss0214
aliassss0214 aliassss0214
  • 20-11-2019

Answer:

y=-1(x-6)^2+32

Step-by-step explanation:

vertex form: y=a(x-h) ^2+k

you have your equation in standard form : ax^2+bx+c

how to change it:

vertex x=(-b)/2(a)

x=-(12)/2(-1)

x=6

substitute x into original (standard-form) equation to find y

vertex y=-(6)^2+12(6)-4

y=32

substitute those values into your vertex (h,k) : (6,32)

y=-1(x-6)^2+32

hope this helps!! :)

Answer Link

Otras preguntas

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
An organization's level of differentiation is best determined by examining:
What number is 352 larger than 1214
Choose one example from the excerpt that shows strong emotional language or exaggeration. Why does Roosevelt choose to use such emotional language or exaggerati
Bella forgot to pay her college account of $1,800 until it was 70 days overdue. She was charged a penalty of $59.50. Find the rate of interest that was charged
24 songs to 78 songs. Find the percent of change. Round to the nearest tenth if necessary
"... (A)ll men are by nature equally free and independent, and have certain inherent rights... namely, the enjoyment of life and liberty, with the means of ac
The plant grew towards the window
He used compelling facts to_____his argument
The solubility of copper(i) chloride is 3.91 mg per 100.0 ml of solution. calculate ksp for cucl (cucl=99.00 g mol-1).