alexissamyria1 alexissamyria1

20-01-2023
Mathematics

contestada

find the value of c that (x+2) is a factor of the polynomial p(x)
p(x)=x^4-x^3+cx^2+3x-2

Respuesta :

Otras preguntas

Data concerning A Corporation's single product appear below: Per Unit Percent of Sales Selling price $ 160 100% Variable expenses 48 30% Contribution margin

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

Please help!! due very soon

SIMPLIFY the expression - 4(2x - 3)

please help me on this

10. Hank bought a four-family residence for rental property. Hank put 20% down on the $300,000 rental unit. How much will he be able to depreciate using the cla

Describe how you expect the waveform and the sound you hear changes when you hit the tuning fork harder.

16. How does aspirin relieve the symptoms of the flu? (1) It forms a barrier around the outer surface of PGHS-2 molecules, separating them from the prostaglandi

Geometry(please help on 1 and 2)

A rectangular box has a length of 9 inches, width of 5 inches, and hight of 1 foot. Find the volume of the box in cubic inches.