sharidler sharidler

16-12-2022
Biology

contestada

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Respuesta :

Otras preguntas

[15-(|-6+2|+ squareroot9)]^2 can anyone explain the steps for how to solve it too? i’m confused :(

What is health to you?

What do the nuclei of 1H hydrogen atoms contain? protons only electrons and protons electrons and neutrons neutrons only

Compare and Contrast the rise of the following economic theories as a result of industrialization: Capitalism, Socialism, and Communism. Please write at least 1

answer explerts help pleaseee show steps also

What are chemical contaminants? 1)Homemade soaps. 2)Restaurant grade cleaners. 3)Alcohol. 4)Recreational drugs.

Solve the inequality. Then graph your solution. -9v – 10 < 7y +6

3. When six is added to six times a number the result obtained is the same as when the number is added to 10 and the result multiplied by 3. Form an equation an

what type of number is 4 plus 5 StartRoot 2 EndRoot?

What is Khilafat movement 1919?